Assume that you transfer bacteria that were grown on heavy ¹⁵N nitrogen to regular medium. What percentage of the DNA is composed of one heavy and one light chain after three generations?

	a. 25%
	b. 50%
	c. 75%
	d. 100%

.

DNA replication is _____.

	a. Semiconservative
	b. Conservative
	c. Dispersive
	d. Random

.

In Mendel’s garden, pea plants with purple flowers were crossed. In the F1 generation, 75% of the plants had purple flowers, and 25% of the plants had white flowers.

	a. This is because the purple flower phenotype is recessive, the white flower phenotype is dominant, and both parent plants were heterozygous.
	b. This is because the purple flower phenotype is recessive, the white flower phenotype is dominant, and both parent plants were homozygous.
	c. This is because the purple flower phenotype is dominant, the white flower phenotype is recessive, and both parent plants were heterozygous.
	d. This is because the purple flower phenotype is dominant, the white flower phenotype is recessive, and both parent plants were homozygous.

.

In Mendel’s garden, pea plants with round and wrinkled seeds were crossed. All F1 generation had round seeds. In the F2 generation, 75% of the plants had round seeds, and 25% of the plants had wrinkled seeds.

	a. This is because the round seed phenotype is recessive, the wrinkled seed phenotype is dominant, and both parent plants were heterozygous.
	b. This is because the round seed phenotype is recessive, the wrinkled seed phenotype is dominant, and both parent plants were homozygous.
	c. This is because the round seed phenotype is dominant, the wrinkled seed phenotype is recessive, and both parent plants were heterozygous.
	d. This is because the round seed phenotype is dominant, the wrinkled seed phenotype is recessive, and both parent plants were homozygous.

.

Morgan’s genetic linkage experiments show that genes, which are _____ each other, recombine _____ than genes that are _____ each other.

	a. Further away from; more frequently; close to
	b. Further away from; less frequently; close to
	c. Close to; more frequently; further away from
	d. Close to; same frequency; further away from

.

The conclusion of the Beadle and Tatum experiment on Neurospora crassa was the _____.

	a. one gene—one enzyme hypothesis
	b. one gene—one RNA hypothesis
	c. one gene—one protein hypothesis
	d. one protein—one RNA hypothesis

.

The Hershey–Chase experiment employed T2 bacteriophage labeled with either radioactive sulfur (³⁵S) or radioactive phosphorus (³²P). The radioactively labeled T2 bacteriophage was used to infect E. coli. Hershey and Chase found that only _____ entered into E. coli. They concluded that _____, not _____ is the _____.

	a. 32P; DNA; protein; transforming principle
	b. 35S; DNA; protein; transforming principle
	c. 32P; DNA; protein; hereditary material
	d. 35S; DNA; protein; hereditary material

.

What was not known at the time when Franklin published the #51 X-ray diffraction picture of the B-form of the DNA?

	a. The genetic code
	b. DNA is composed of bases, sugar, and phosphate
	c. The Chargaff's rules
	d. DNA is the hereditary material

.

DNA is typically _____, while RNA is _____.

	a. Double stranded helix; single stranded.
	b. Single stranded helix; double stranded.
	c. Triple helix; single stranded.
	d. Double stranded helix; triple helix

.

Enzymes and ribozymes are _____ that act through _____ the activation energy of metabolic reactions.

	a. Proteins and ribosomes, respectively; stabilizing
	b. Proteins and ribosomes, respectively; diminishing
	c. Biological catalysts; increasing
	d. Biological catalysts; lowering

.

In a DNA sample, 40% of all bases are G. What is the A content in this DNA sample?

	a. 40%
	b. 20%
	c. 10%
	d. 30%

.

In the _____ groove of the DNA, bases are _____ and can ¬_____ with other molecules.

	a. Minor; hidden; interact
	b. Major; hidden; not interact
	c. Minor; exposed; interact
	d. Major; exposed; interact

.

Proteins are polymers of _____ that are directly translated from _____ molecule sequences.

	a. Amino acids; ribosome
	b. Amino acids; tRNA
	c. Amino acids; DNA
	d. Amino acids; mRNA

.

The sequence of the RNA molecule, which can hybridize with the TGCAATGCCTA molecule, is _____. Please keep in mind that the sequence of nucleic acids is written 5' to 3' orientation conventionally.

	a. ATCCGTAACGT
	b. TAGGCATTGCA
	c. UAGGCAUUGCA
	d. ACGUUACGGAU

.

_____ are binding to _____ of enzymes and converted ¬into a _____.

	a. Products; active site; substrate
	b. Substrates; allosteric site; product
	c. Products; allosteric site; substrate
	d. Substrates; active site; product

.

The reverse complement of 3'-TAGGCATTGCA-5' ssDNA is _____ ssDNA.

	a. 3'-ATCCGTAACGT-5'
	b. 5'-ATCCGTAACGT-3'
	c. 5'-TGCAATGCCTA-3'
	d. 5'-TAGGCATTGCA-3'

.

Besides histone modifications, chromatin remodeling complexes play a role in turning genes on. The chromatin remodeling complex _____ to unwrap, mobilize, eject, or exchange _____ from the nucleosome, and it recruits transcription factors to initiate _____.

	a. uses the energy of ATP; histones; transcription
	b. makes ATP; DNA; transcription
	c. dephosphorylates; lamin; translation
	d. removes histone tail modifications; histone heads; translation

.

Histone demethylation enhances _____ chromosomal structure, thus it enhances gene_____.

	a. looser; translation
	b. tighter; translation
	c. looser; transcription
	d. tighter; transcription

.

The higher order chromosomal structure includes _____ complexes that are rich in _____.

	a. histone; acetyl transferase
	b. scaffold; topoisomerase
	c. lamine; phosphatase
	d. nucleolus; RNA

.

The nucleus reforms at the end of mitosis. This means that _____.

	a. Nuclear lamina should reassemble, which requires the dephosporylation of lamins
	b. Nuclear lamina should disassemble, which requires the phosphorylation of lamins
	c. Nuclear lamina should disassemble, which requires phosphatase activity.
	d. Nuclear lamina should reassemble, which requires kinase activity.

.

The _____ charged DNA is wrapped around _____ proteins in the nucleosome.

	a. Positively; basic histone
	b. Negatively; basic histone
	c. Negatively; acidic histone
	d. Positively; acidic histone

.

The _____ regions are _____, thus _____ genes are expressed there.

	a. Heterochromatin; very condensed; few if any.
	b. Euchromatin; very condensed; few if any.
	c. Heterochromatin; hardly condensed; few if any.
	d. Euchromatin; very condensed; few if any.

.

The ______ modifications of the histone tails are _____, thus genes can be switched on and off with histone modifications.

	a. Chemical; reversible
	b. Physical; reversible
	c. Chemical; irreversible
	d. Physical; irreversible

.

Histone deacetylation enhances chromosome _____, thus the chromosomal segment cannot be _____.

	a. Condensation; translated
	b. Condensation; transcribed
	c. De-condensation; translated
	d. De-condensation; transcribed

.

DNA _____ are enzymes that _____ the strands of dsDNA. The enzyme forms a ring-shaped complex and pulls a DNA strand through its central hole.

	a. Topoisomerases; cleave
	b. Helicases; separate
	c. Polymerases; elongate
	d. Replication complexes; bind to

.

DNA _____ are enzymes that _____, relax, and _____ supercoiled dsDNA.

	a. Topoisomerases; cleave; reseal
	b. Helicases; separate; supercoil
	c. Polymerases; copy; elongate
	d. Replication complexes; bind to; copy

.

Most of the known DNA replication is bidirectional. A bacterial chromosome has _____ , yeast has ¬_____, and multicellular eukaryotes have _____origin of replication.

	a. Multiple copies; multiple copies; multiple copies
	b. One copy; one copy; one copy
	c. One copy; multiple copies; multiple copies
	d. One copy; one copy; multiple copies

.

Okazaki fragments are produced during DNA replication because_____.

	a. DNA polymerase is frequently released from the template strand, thus it has to start the synthesis of a new piece
	b. DNA polymerase cannot start DNA synthesis; it can only add nucleotides to an existing strand
	c. DNA polymerase can add nucleotides only to the 3' end of the growing strand
	d. DNA polymerase can add nucleotides only to the 5' end of the growing strand

.

Telomerase is an enzyme that can elongate the repeat-rich telomere regions of a linear chromosome. This enzyme is a _____.

	a. DNA polymerase, which does not require priming
	b. Ligase, which can link telomere regions to the end of linear chromosomes
	c. DNA polymerase, which can add nucleotides to 5'-ends
	d. Reverse transcriptase associated with an RNA primer

.

_____ is linked to the _____ of the linear chromosomes during replication. This happens only in linear chromosomes because DNA polymerase cannot replace the 5'-end primers.

	a. Hayflick’s limit; shortening
	b. Priming; elongation
	c. Ligation; conjugation
	d. Okazaki fragment; primer

.

_____ proteins keep the template DNA and the DNA polymerases associated, which is essential for an uninterrupted DNA strand synthesis.

	a. Clamp-loading
	b. Helicase
	c. Sliding clamp
	d. Replication origin

.

During DNA replication, the _____ is synthesized continuously, while the _____ is synthesized in pieces and linked by a ligase later on.

	a. Okazaki fragment; template
	b. Lagging; leading
	c. Leading strand; lagging
	d. Template; leading

.

DNA polymerases are “processive” enzymes. Processive enzymes catalyze subsequent chemical reactions on a polymer substrate _____, while dispersive enzymes _____ between two subsequent catalytic reactions.

	a. Without releasing the substrate; release the polymer substrate
	b. Utilizing the work of many enzymes at the same time on one polymer; work without releasing the substrate
	c. Resulting in the growth of the substrate; shorten the polymer by one monomer unit
	d. With a high reaction rate; progress very slowly

.

During transcription in eukaryotes, RNA transcripts are capped _____.

	a. Before the first 30 nucleotides are transcribed
	b. When the mRNA transcription is finished
	c. After the RNA enters the cytoplasm
	d. When the first two nucleotides are linked with a phosphodiester bond

.

Gene expression in prokaryotes and eukaryotes¬ _____.

	a. Follow the exact same mechanism
	b. Are somewhat different: in prokaryotes transcription and translation take place simultaneously, while they are separated in eukaryotes
	c. Are somewhat different: in eukaryotes transcription and translation take place simultaneously, while they are separated in prokaryotes
	d. Are indistinguishable with an exception of translation at the rough ER, which is slower in prokaryotes

.

In eukaryotes mRNA _____, and transcription takes place in the _____.

	a. Is not processed; nucleus
	b. Is processed; cytoplasm
	c. Is capped, polyadenylated, and spliced; nucleus
	d. Is not processed; cytoplasm

.

In eukaryotes, _____ removes _____ and links _____. Such RNA processing is nonexistent in prokaryotes.

	a. Splisosome; introns; exons
	b. Splisosome; exons; introns
	c. Ribosome; introns; exons
	d. Ribosome; exons; introns

.

In prokaryotes mRNA _____, and transcription takes place in the _____.

	a. Is not processed; nucleus
	b. Is processed; cytoplasm
	c. Is capped, polyadenylated, and spliced; nucleus
	d. Is not processed; cytoplasm

.

MicroRNA has been discovered recently; it is a _____ regulator of_____.

	a. Rare; protein
	b. Common; protein
	c. Rare; RNA turnover
	d. Common; RNA turnover

.

Processing bodies (P-bodies) are _____, where _____ break(s) down RNA, and they also store _____ RNA molecules.

	a. Ribozymes; RNase; freshly synthesized mRNA
	b. Enzymes; subunits; pre-mRNA
	c. Scaffolding centers; miRNA; translationally repressed
	d. Splicing centers; ribozymes; alternatively spliced mRNA

.

Riboswitches are _____ that can silence protein expression if a _____ binds to them.

	a. 5' mRNA regions; certain metabolite
	b. Transcription factors; second messenger
	c. Ribosome components; translation elongation factor
	d. 3' mRNA regions; certain nutrient

.

Alternative splicing _____.

	a. Links different exons of one pre-mRNA to produce several mature mRNA
	b. Links different exons of two pre-mRNAs to produce several mature mRNA
	c. Is modifying gene structure by splicing out regions of a chromosome.
	d. Is a chromosomal inversion, which is responsible for making new genes

.

EST sequences are used to predict protein sequences based on their alignment to _____.

	a. genomic DNA
	b. mRNA
	c. cDNA
	d. introns

.

How many amino acids are in the eukaryotic protein, which has a 3213 nucleotide long open reading frame, including the start and the stop codons?

	a. 1070
	b. 1069
	c. 1071
	d. 3210

.

In the presence of a selenocysteine insertion (SECIS) element in the mRNA, the UCA anticodon translates into selenosysteine in many redox enzymes. In the absence of the SECIS element, the UCA is the umber stop codon. Which mRNA codon would the UCA anticodon pair with? Keep in mind that base-pairing occurs between antiparallel nucleic acids.

	a. UGA
	b. UCA
	c. TCA
	d. TGA

.

mRNA is translated in a _____ direction, and proteins are synthesized in a _____ direction.

	a. 5' to 3'; carboxy to amino terminus
	b. 5' to 3'; amino to carboxy terminus
	c. 3' to 5'; carboxy to amino terminus
	d. 3' to 5'; amino to carboxy terminus

.

Only part of the mRNA molecule is translated into protein. This translated region is called

	a. Open reading source
	b. Mature mRNA
	c. Open reading frame
	d. Spliced mRNA

.

Protein synthesis is terminated when _____.

	a. The protein release factor binds to a stop codon at the A site of the ribosome
	b. An uncharged tRNA is bound to a stop codon at the A site of the ribosome
	c. A termination factor cleaves off the growing polypeptide chain
	d. The mRNA ends at the stop codon and runs off the ribosome

.

The anticodon for tryptophan (Trp) is 5'-CCA-3'. Which mRNA codon would the Trp-tRNA pair with?

	a. 3'-CCA-5'
	b. 5'-CCA-3'
	c. 3'-UGG-3'
	d. 5'-UGG-3'

.

The selection of the starter methionine codon is helped by the _____ in prokaryotes and _____ in eukaryotes. Both sequences are at the 5' end of the mRNA.

	a. Kozak sequence; also by the Kozak;
	b. Shine-Delgarno sequence; by the Kozak sequence
	c. Kozak sequence; by the Shine-Delgarno sequence
	d. Shine-Delgarno sequence; also by the Shine-Delgarno sequence

.

Use the standard genetic code table to determine which mRNA codes for the following protein: Met-Arg-Gly-Tyr-Ala-Arg.

	a. ATGCGAGGCTATGCUCGGTGA
	b. AUGCGAGGCUAUGCUCGGUGA
	c. AGUGGCUCGUAUGGGAGCGUA
	d. AGTGGCTCGTATGGGAGCGTA

.

Which of the following is true about these nucleic acids?

	a. The template of the RNA can be ssDNA-2; ssDNA-1 is unrelated
	b. The template of the RNA can be ssDNA-1; ssDNA-2 is unrelated
	c. ssDNA-1 and ssDNA-2 can be complement strands, but they are unrelated to the RNA
	d. All three nucleic acids are unrelated

.

Which of the following is true regarding open reading frames?

	a. DNA sequences can be read in six open reading frames: three forward and three reverse
	b. DNA sequences can be read in three open reading frames: three forward
	c. DNA sequences can be read in one open reading frame: one forward
	d. DNA sequences can be read in two open reading frames: one forward and one reverse

.

Which of the following statement is true?

	a. Aminoacyl-transfer RNA synthetase has no proofreading activity.
	b. tRNA spontaneously reacts with an amino acid, since this reaction is thermodynamically favorable.
	c. Aminoacyl-transfer RNA synthetase links the carboxyl group of an amino acid to a tRNA ribose hydroxyl group through an ester bond.
	d. Only one enzyme is needed to charge all tRNAs with the appropriate amino acid.

.

_____ is used in the third anticodon base position of the tRNA to allow the recognition of _____ by one base.

	a. Inosine; A, C, U
	b. Nicotinamide; G, U
	c. Flavin; A, G, U
	d. Niacin; A, U

.

How many nucleotides are in the coding region of a eukaryotic mRNA, including the start and the stop codons?

	a. 112
	b. 150
	c. 173
	d. 211

.

In E. coli, the gene lacI codes the lac operon repressor. Which of the following statements is true about an E. coli strain, which is lacI-, that is null mutant for lacI.

	a. There would be no lac operon repression, thus lacA, lacZ and lacY genes would be constitutively expressed regardless of the presence of lactose.
	b. There would be no lac operon repression, thus lacA, lacZ and lacY genes would be expressed in the presence of lactose.
	c. There would be no lac operon repression, thus lacA, lacZ and lacY genes would be constitutively expressed regardless of the presence of glucose.
	d. There would be no lac operon repression, thus lacA, lacZ and lacY genes would be expressed in the presence of allolactose.

.

Methylation is an epigenetic change, which chemically modifies ______ in the chromosome.

	a. DNA and histones
	b. DNA
	c. Histone
	d. RNA

.

Repressible operons are typical in _____, e.g., the _____. And inducible operons are typical in _____, e.g., the _____.

	a. Catabolic pathways; lac operon; anabolic pathways; trp operon
	b. Catabolic pathways; trp operon; anabolic pathways; lac operon
	c. Anabolic pathways; lac operon; catabolic pathways; trp operon
	d. Anabolic pathways; trp operon; catabolic pathways; lac operon

.

The DNA methylation pattern, what we inherit from our parents, is _____; the DNA methylation pattern, what we acquire as we age, is _____. _____ can be inherited.

	a. Denomic imprinting; de novo methylation; none of them
	b. De novo methylation; genomic imprinting; none of them
	c. Genomic imprinting; de novo methylation; both of them
	d. Genomic imprinting; de novo methylation; none of them

.

When lactose is _____, the lac operon is _____, since a _____ binding to the operator within the operon.

	a. Absent; inactive; repressor is
	b. Present; inactive; repressor is not
	c. Absent; active; repressor is not
	d. Present; active; repressor is

.

When tryptophan is present in sufficient quantities, the trp operon is _____, since the _____ binds to the operator within the operon.

	a. Turned off; tryptophan-activated repressor
	b. Turned on; tryptophan-activated repressor
	c. Turned off; tryptophan-inhibited repressor
	d. Turned on; tryptophan-inhibited repressor

.

_____ is determined by the _____ of activators that are available in a particular tissue to bind to genomic enhancer regions.

	a. Tissue specific gene expression; combination
	b. Genomic imprinting; absence
	c. X inactivation; absence
	d. Development; abundance

.

_____ activates the lac operon, when the _____ level is low.

	a. Catabolite activator protein (CAP); lactose
	b. Allolactose; cAMP
	c. The catabolite activator protein (CAP); glucose
	d. cAMP; lactose

.

DNA repair mechanisms can excise ______.

	a. Either altered bases or nucleotides
	b. Only altered bases by cleaving the base–sugar bonds
	c. Only nucleotides by cleaving phosphodiester bonds
	d. Only apurinic sites

.

Hypermutation in immunoglobulins is the result of an unusual ______ response: the ______ strand is corrected, not the ______ strand.

	a. Mismatch repair; daughter; parent
	b. Mutagen activity; daughter; parent
	c. Mismatch repair; parent; daughter
	d. Mutagen activity; parent; daughter

.

Loss-of-function mutation generally results in ______

	a. Slower protein turnover
	b. No gene product
	c. Lower metabolic rate
	d. Loss of inhibition

.

The mismatch repair system has to recognize the ______ strand and repair mutations only in this strand. To achieve this, bacteria is utilizing the postreplicational delay in ______.

	a. New; adenine methylation
	b. Old; adenine methylation
	c. New; Okazaki fragment ligation
	d. New; Okazaki fragment ligation

.

The replicated strand of the DNA is repaired ______ the parent strand.

	a. More rapidly than
	b. At the same rate as
	c. Less rapidly than
	d. Less efficiently than

.

The ______ response repair is ______, since it fills a gap at the parental side after replication.

	a. SOS; inaccurate
	b. Recombinational; error-prone
	c. Postreplicational; always high fidelity
	d. SOS; high fidelity

.

Which of the following conditions is the consequence of a translocation event between nonhomologous chromosomes?

	a. Cystic fibrosis
	b. Fragile X syndrome
	c. Philadelphia syndrome
	d. Huntington’s disease

.

We are talking about mutation when an allele is different from the wild type allele. The most dramatic change is the consequence of a(n) ______ mutation, which is introducing an ORF into the transcript.

	a. Early nonsense
	b. Early silent
	c. Late missense
	d. Late frameshift

.

BRCA1 and BRCA 2 genes are involved in the ______.

	a. SOS repair mechanism
	b. Initiating DNA replication
	c. Homologous recombination of chromosomes
	d. Terminating RNA transcription

.

During ______, cromatids take place, which results in genetic ______ and contributes to DNA repair.

	a. Crossing over of nonsister; variability
	b. Crossing over of sister; variability
	c. Crossing over of nonsister; stability
	d. Crossing over of sister; stability

.

Retrotransposons use a ______ and a ______ during their relocation into a new site in the chromosome.

	a. RNA intermadiate; retrotransposase
	b. DNA intermediate; retrotransposase
	c. RNA intermediate; reverse transcriptase
	d. DNA intermediate; reverse transcriptase

.

Retroviruses ______ insert into the host genome and ______ move around in the genome as a transposon.

	a. Can; can
	b. Can; cannot
	c. Cannot; cannot
	d. Cannot; can

.

The Holiday junction is a model for______.

	a. DNA crossover
	b. DNA ligation
	c. SOS gap repair
	d. PCR amplification

.

Transposons are jumping genes, but none of them can move around by ______.

	a. Retrotransposase
	b. The cut-and-paste mechanism
	c. The involvement of a reverse transcriptase
	d. The copy-and-paste mechanism

.

______ may result in novel ______ of domains from different proteins.

	a. Exon shuffling; combination
	b. Alternative splicing; combination
	c. Exon shuffling; conformation
	d. Alternative splicing; conformation

.

Which of the following is not a DNA damage type?

	a. Mismatch
	b. Strand separation
	c. Backbone break
	d. Crosslink between bases

.

A cloning plasmid typically has a(n) ______, a ______, and a______.

	a. Antibiotic resistance gene; cloning site; reporter gene
	b. Restriction enzyme gene; ligase gene; repair gene
	c. PCR amplified segment; GC-rich region; reporter gene
	d. Antibiotic resistance gene; ligation site; repair gene

.

CGATTGCAGGTTATAGCG. Which of the following primer pair can be used to amplify this template with PCR?

	a. GCTAA and TAGCG
	b. GCTAA and CGCTA
	c. CGATT and TAGCG
	d. CGATT and CGCTA

.

Cloning vectors utilize ______, wherein the ______ DNA can be inserted.

	a. Multiple-cloning site; foreign
	b. Ligation site; foreign
	c. PCR site; antibiotic resistance gene
	d. Insertion site; reporter gene

.

DNA fragments with ______ ends can be easily joined by a ______, if the fragments are made by one restriction enzyme.

	a. Sticky; ligase
	b. Blunt; ligase
	c. Sticky; DNA polymerase
	d. Blunt; DNA polymerase

.

Ligases ______ DNA segments by _____.

	a. Link; phosphodiester bonds
	b. Repair; excision
	c. Restrict the replication of; linking them to lamins
	d. Link RNA primer to; phosphodiester bond at the beginning of the replication

.

Restriction enzymes are ______ that ______ the DNA at specific ______.

	a. Ligases; seal fragments of; sites
	b. DNases; cut; developmental stages
	c. Molecular scissors; cut; recognition sites
	d. Polymerases; replicate; locations

.

The key of the dideoxy DNA sequencing method is the missing ______.

	a. 3'OH of the sugar
	b. 2'OH of the sugar
	c. Terminal phosphate group
	d. Chain terminating polymerase

.

There is a ______ fold amplification after six completed PCR cycles.

	a. 16
	b. 32
	c. 64
	d. 128

.

Which of the following method is paired wrongly with its product?

	a. Polymerase chain reaction—DNA amplification
	b. Ion exchange chromatography—purified RNA
	c. Restriction enzyme digestion—DNA fragments
	d. Ligation—joined DNA fragments

.

______ are frequently used in cloning plasmid, and they are enzyme genes. They include a ______, where the foreign gene can be inserted. The insertion results in the ______ of the enzyme activity, which is often followed by a color reaction.

	a. Reporter genes; cloning site; disruption
	b. Antibiotic resistance genes; cloning site; inhibition
	c. Multicloning sites; restriction enzyme recognition site; amplification
	d. PCR sites; restriction enzyme recognition site; amplification

.

______ extracts proteins utilizing specific interactions.

	a. Ion exchange chromatography
	b. Affinity chromatography
	c. Ultracentrifugation
	d. 2D gelelectrophoresis

.

Electrophoresis is separating molecules based on their______.

	a. Charge
	b. Charge and size
	c. Size
	d. Shape

.

Molecular biology research resulted in many ______ transgenic mouse strains. Mouse is the most commonly used transgenic mammal in gene function discovery.

	a. Knock-out and knock-in
	b. Transposon induced
	c. Mutagen induced
	d. Knock over

.

The insertion of the foreign DNA has often been checked by the ______blot technique.

	a. Southern
	b. Western
	c. Northern
	d. Protein

.

Traditional breeding, just like transgenic technology, results in organisms that have desired traits. A major difference is that transgenic technology moves genes______, while traditional breeding crosses individuals ______.

	a. From one species to another; within a species
	b. Within a species; from different species
	c. And produces new strains slowly; and gets the result within a generation
	d. but the produced strains are not homogenous; and easily gets clones

.

______ is a favorite model organism from the early days of genetics. It taught us how to link gene distance and genetic recombination frequencies, body plan development, and molecular mechanisms of learning and memory, just to mention a few.

	a. Escherichia coli
	b. Saccharomyces cerevisiae
	c. Caenorhabditis elegans
	d. Drosophila melanogaster

.

______ is a transparent animal with 556 cells. The basic mechanism of programmed cell death has been deciphered in this model organism.

	a. Escherichia coli
	b. Saccharomyces cerevisiae
	c. Caenorhabditis elegans
	d. Drosophila melanogaster

.

______ is perhaps the most common eukaryote in molecular biology labs. It is also widely used in commercial fermentation applications.

	a. Escherichia coli
	b. Saccharomyces cerevisiae
	c. Caenorhabditis elegans
	d. Penicillium chrysogenum

.

______ is the most successfully used plant model organism. It taught us the basics of plant physiology, and it is also the most frequently used plant model for GMO pilot experiments.

	a. Arabidopsis thaliana
	b. Zea mays
	c. Oryza sativa
	d. Allium cepa

.

______ is perhaps the most common prokaryote in molecular biology labs. It is also widely used by the biotech industry to manufacture proteins, e.g., insulin.

	a. Escherichia coli
	b. Saccharomyces cerevisiae
	c. Caenorhabditis elegans
	d. Penicillium chrysogenum

.