Assume that you transfer bacteria that were grown on heavy ¹⁵N nitrogen to regular medium. What percentage of the DNA is composed of one heavy and one light chain after three generations?

Choose one answer.

	a. 25%
	b. 50%
	c. 75%
	d. 100%

Question 2

DNA replication is _____.

Choose one answer.

	a. Semiconservative
	b. Conservative
	c. Dispersive
	d. Random

Question 3

In Mendel's garden, pea plants with purple flowers were crossed. In the F1 generation, 75% of the plants had purple flowers, and 25% of the plants had white flowers.

Choose one answer.

	a. This is because the purple flower phenotype is recessive, the white flower phenotype is dominant, and both parent plants were heterozygous.
	b. This is because the purple flower phenotype is recessive, the white flower phenotype is dominant, and both parent plants were homozygous.
	c. This is because the purple flower phenotype is dominant, the white flower phenotype is recessive, and both parent plants were heterozygous.
	d. This is because the purple flower phenotype is dominant, the white flower phenotype is recessive, and both parent plants were homozygous.

Question 4

In Mendel's garden, pea plants with round and wrinkled seeds were crossed. All F1 generation had round seeds. In the F2 generation, 75% of the plants had round seeds, and 25% of the plants had wrinkled seeds.

Choose one answer.

	a. This is because the round seed phenotype is recessive, the wrinkled seed phenotype is dominant, and both parent plants were heterozygous.
	b. This is because the round seed phenotype is recessive, the wrinkled seed phenotype is dominant, and both parent plants were homozygous.
	c. This is because the round seed phenotype is dominant, the wrinkled seed phenotype is recessive, and both parent plants were heterozygous.
	d. This is because the round seed phenotype is dominant, the wrinkled seed phenotype is recessive, and both parent plants were homozygous.

Question 5

Morgan's genetic linkage experiments show that genes, which are _____ each other, recombine _____ than genes that are _____ each other.

Choose one answer.

	a. Further away from; more frequently; close to
	b. Further away from; less frequently; close to
	c. Close to; more frequently; further away from
	d. Close to; same frequency; further away from

Question 6

The conclusion of the Beadle and Tatum experiment on Neurospora crassa was the _____.

Choose one answer.

	a. one gene-one enzyme hypothesis
	b. one gene-one RNA hypothesis
	c. one gene-one protein hypothesis
	d. one protein-one RNA hypothesis

Question 7

The Hershey-Chase experiment employed T2 bacteriophage labeled with either radioactive sulfur (³⁵S) or radioactive phosphorus (³²P). The radioactively labeled T2 bacteriophage was used to infect E. coli. Hershey and Chase found that only _____ entered into E. coli. They concluded that _____, not _____ is the _____.

Choose one answer.

	a. ³²P; DNA; protein; transforming principle
	b. ³⁵S; DNA; protein; transforming principle
	c. ³²P; DNA; protein; hereditary material
	d. ³⁵S; DNA; protein; hereditary material

Question 8

What was not known at the time when Franklin published the #51 X-ray diffraction picture of the B-form of the DNA?

Choose one answer.

	a. The genetic code
	b. DNA is composed of bases, sugar, and phosphate
	c. The Chargaff's rules
	d. DNA is the hereditary material

Question 9

DNA is typically _____, while RNA is _____.

Choose one answer.

	a. Double stranded helix; single stranded.
	b. Single stranded helix; double stranded.
	c. Triple helix; single stranded.
	d. Double stranded helix; triple helix

Question 10

Enzymes and ribozymes are _____ that act through _____ the activation energy of metabolic reactions.

Choose one answer.

	a. Proteins and ribosomes, respectively; stabilizing
	b. Proteins and ribosomes, respectively; diminishing
	c. Biological catalysts; increasing
	d. Biological catalysts; lowering

Question 11

In a DNA sample, 40% of all bases are G. What is the A content in this DNA sample?

Choose one answer.

	a. 40%
	b. 20%
	c. 10%
	d. 30%

Question 12

In the _____ groove of the DNA, bases are _____ and can ¬_____ with other molecules.

Choose one answer.

	a. Minor; hidden; interact
	b. Major; hidden; not interact
	c. Minor; exposed; interact
	d. Major; exposed; interact

Question 13

Proteins are polymers of _____ that are directly translated from _____ molecule sequences.

Choose one answer.

	a. Amino acids; ribosome
	b. Amino acids; tRNA
	c. Amino acids; DNA
	d. Amino acids; mRNA

Question 14

The sequence of the RNA molecule, which can hybridize with the TGCAATGCCTA molecule, is _____. Please keep in mind that the sequence of nucleic acids is written 5' to 3' orientation conventionally.

Choose one answer.

	a. ATCCGTAACGT
	b. TAGGCATTGCA
	c. UAGGCAUUGCA
	d. ACGUUACGGAU

Question 15

_____ are binding to _____ of enzymes and converted ¬into a _____.

Choose one answer.

	a. Products; active site; substrate
	b. Substrates; allosteric site; product
	c. Products; allosteric site; substrate
	d. Substrates; active site; product

Question 16

The reverse complement of 3'-TAGGCATTGCA-5' ssDNA is _____ ssDNA.

Choose one answer.

	a. 3'-ATCCGTAACGT-5'
	b. 5'-ATCCGTAACGT-3'
	c. 5'-TGCAATGCCTA-3'
	d. 5'-TAGGCATTGCA-3'

Question 17

Besides histone modifications, chromatin remodeling complexes play a role in turning genes on. The chromatin remodeling complex _____ to unwrap, mobilize, eject, or exchange _____ from the nucleosome, and it recruits transcription factors to initiate _____.

Choose one answer.

	a. uses the energy of ATP; histones; transcription
	b. makes ATP; DNA; transcription
	c. dephosphorylates; lamin; translation
	d. removes histone tail modifications; histone heads; translation

Question 18

Histone demethylation enhances _____ chromosomal structure, thus it enhances gene_____.

Choose one answer.

	a. looser; translation
	b. tighter; translation
	c. looser; transcription
	d. tighter; transcription

Question 19

The higher order chromosomal structure includes _____ complexes that are rich in _____.

Choose one answer.

	a. histone; acetyl transferase
	b. scaffold; topoisomerase
	c. lamine; phosphatase
	d. nucleolus; RNA

Question 20

The nucleus reforms at the end of mitosis. This means that _____.

Choose one answer.

	a. Nuclear lamina should reassemble, which requires the dephosporylation of lamins
	b. Nuclear lamina should disassemble, which requires the phosphorylation of lamins
	c. Nuclear lamina should disassemble, which requires phosphatase activity.
	d. Nuclear lamina should reassemble, which requires kinase activity.

Question 21

The _____ charged DNA is wrapped around _____ proteins in the nucleosome.

Choose one answer.

	a. Positively; basic histone
	b. Negatively; basic histone
	c. Negatively; acidic histone
	d. Positively; acidic histone

Question 22

The _____ regions are _____, thus _____ genes are expressed there.

Choose one answer.

	a. Heterochromatin; very condensed; few if any.
	b. Euchromatin; very condensed; few if any.
	c. Heterochromatin; hardly condensed; few if any.
	d. Euchromatin; very condensed; few if any.

Question 23

The ______ modifications of the histone tails are _____, thus genes can be switched on and off with histone modifications.

Choose one answer.

	a. Chemical; reversible
	b. Physical; reversible
	c. Chemical; irreversible
	d. Physical; irreversible

Question 24

Histone deacetylation enhances chromosome _____, thus the chromosomal segment cannot be _____.

Choose one answer.

	a. Condensation; translated
	b. Condensation; transcribed
	c. De-condensation; translated
	d. De-condensation; transcribed

Question 25

DNA _____ are enzymes that _____ the strands of dsDNA. The enzyme forms a ring-shaped complex and pulls a DNA strand through its central hole.

Choose one answer.

	a. Topoisomerases; cleave
	b. Helicases; separate
	c. Polymerases; elongate
	d. Replication complexes; bind to

Question 26

DNA _____ are enzymes that _____, relax, and _____ supercoiled dsDNA.

Choose one answer.

	a. Topoisomerases; cleave; reseal
	b. Helicases; separate; supercoil
	c. Polymerases; copy; elongate
	d. Replication complexes; bind to; copy

Question 27

Most of the known DNA replication is bidirectional. A bacterial chromosome has _____ , yeast has ¬_____, and multicellular eukaryotes have _____origin of replication.

Choose one answer.

	a. Multiple copies; multiple copies; multiple copies
	b. One copy; one copy; one copy
	c. One copy; multiple copies; multiple copies
	d. One copy; one copy; multiple copies

Question 28

Okazaki fragments are produced during DNA replication because_____.

Choose one answer.

	a. DNA polymerase is frequently released from the template strand, thus it has to start the synthesis of a new piece
	b. DNA polymerase cannot start DNA synthesis; it can only add nucleotides to an existing strand
	c. DNA polymerase can add nucleotides only to the 3' end of the growing strand
	d. DNA polymerase can add nucleotides only to the 5' end of the growing strand

Question 29

Telomerase is an enzyme that can elongate the repeat-rich telomere regions of a linear chromosome. This enzyme is a _____.

Choose one answer.

	a. DNA polymerase, which does not require priming
	b. Ligase, which can link telomere regions to the end of linear chromosomes
	c. DNA polymerase, which can add nucleotides to 5'-ends
	d. Reverse transcriptase associated with an RNA primer

Question 30

_____ is linked to the _____ of the linear chromosomes during replication. This happens only in linear chromosomes because DNA polymerase cannot replace the 5'-end primers.

Choose one answer.

	a. Hayflick's limit; shortening
	b. Priming; elongation
	c. Ligation; conjugation
	d. Okazaki fragment; primer

Question 31

_____ proteins keep the template DNA and the DNA polymerases associated, which is essential for an uninterrupted DNA strand synthesis.

Choose one answer.

	a. Clamp-loading
	b. Helicase
	c. Sliding clamp
	d. Replication origin

Question 32

During DNA replication, the _____ is synthesized continuously, while the _____ is synthesized in pieces and linked by a ligase later on.

Choose one answer.

	a. Okazaki fragment; template
	b. Lagging; leading
	c. Leading strand; lagging
	d. Template; leading

Question 33

DNA polymerases are "processive" enzymes. Processive enzymes catalyze subsequent chemical reactions on a polymer substrate _____, while dispersive enzymes _____ between two subsequent catalytic reactions.

Choose one answer.

	a. Without releasing the substrate; release the polymer substrate
	b. Utilizing the work of many enzymes at the same time on one polymer; work without releasing the substrate
	c. Resulting in the growth of the substrate; shorten the polymer by one monomer unit
	d. With a high reaction rate; progress very slowly

Question 34

During transcription in eukaryotes, RNA transcripts are capped _____.

Choose one answer.

	a. Before the first 30 nucleotides are transcribed
	b. When the mRNA transcription is finished
	c. After the RNA enters the cytoplasm
	d. When the first two nucleotides are linked with a phosphodiester bond

Question 35

Gene expression in prokaryotes and eukaryotes¬ _____.

Choose one answer.

	a. Follow the exact same mechanism
	b. Are somewhat different: in prokaryotes transcription and translation take place simultaneously, while they are separated in eukaryotes
	c. Are somewhat different: in eukaryotes transcription and translation take place simultaneously, while they are separated in prokaryotes
	d. Are indistinguishable with an exception of translation at the rough ER, which is slower in prokaryotes

Question 36

In eukaryotes mRNA _____, and transcription takes place in the _____.

Choose one answer.

	a. Is not processed; nucleus
	b. Is processed; cytoplasm
	c. Is capped, polyadenylated, and spliced; nucleus
	d. Is not processed; cytoplasm

Question 37

In eukaryotes, _____ removes _____ and links _____. Such RNA processing is nonexistent in prokaryotes.

Choose one answer.

	a. Splisosome; introns; exons
	b. Splisosome; exons; introns
	c. Ribosome; introns; exons
	d. Ribosome; exons; introns

Question 38

In prokaryotes mRNA _____, and transcription takes place in the _____.

Choose one answer.

	a. Is not processed; nucleus
	b. Is processed; cytoplasm
	c. Is capped, polyadenylated, and spliced; nucleus
	d. Is not processed; cytoplasm

Question 39

MicroRNA has been discovered recently; it is a _____ regulator of_____.

Choose one answer.

	a. Rare; protein
	b. Common; protein
	c. Rare; RNA turnover
	d. Common; RNA turnover

Question 40

Processing bodies (P-bodies) are _____, where _____ break(s) down RNA, and they also store _____ RNA molecules.

Choose one answer.

	a. Ribozymes; RNase; freshly synthesized mRNA
	b. Enzymes; subunits; pre-mRNA
	c. Scaffolding centers; miRNA; translationally repressed
	d. Splicing centers; ribozymes; alternatively spliced mRNA

Question 41

Riboswitches are _____ that can silence protein expression if a _____ binds to them.

Choose one answer.

	a. 5' mRNA regions; certain metabolite
	b. Transcription factors; second messenger
	c. Ribosome components; translation elongation factor
	d. 3' mRNA regions; certain nutrient

Question 42

Alternative splicing _____.

Choose one answer.

	a. Links different exons of one pre-mRNA to produce several mature mRNA
	b. Links different exons of two pre-mRNAs to produce several mature mRNA
	c. Is modifying gene structure by splicing out regions of a chromosome.
	d. Is a chromosomal inversion, which is responsible for making new genes

Question 43

EST sequences are used to predict protein sequences based on their alignment to _____.

Choose one answer.

	a. genomic DNA
	b. mRNA
	c. cDNA
	d. introns

Question 44

How many amino acids are in the eukaryotic protein, which has a 3213 nucleotide long open reading frame, including the start and the stop codons?

Choose one answer.

	a. 1070
	b. 1069
	c. 1071
	d. 3210

Question 45

In the presence of a selenocysteine insertion (SECIS) element in the mRNA, the UCA anticodon translates into selenosysteine in many redox enzymes. In the absence of the SECIS element, the UCA is the umber stop codon. Which mRNA codon would the UCA anticodon pair with? Keep in mind that base-pairing occurs between antiparallel nucleic acids.

Choose one answer.

	a. UGA
	b. UCA
	c. TCA
	d. TGA

Question 46

mRNA is translated in a _____ direction, and proteins are synthesized in a _____ direction.

Choose one answer.

	a. 5' to 3'; carboxy to amino terminus
	b. 5' to 3'; amino to carboxy terminus
	c. 3' to 5'; carboxy to amino terminus
	d. 3' to 5'; amino to carboxy terminus

Question 47

Only part of the mRNA molecule is translated into protein. This translated region is called

Choose one answer.

	a. Open reading source
	b. Mature mRNA
	c. Open reading frame
	d. Spliced mRNA

Question 48

Protein synthesis is terminated when _____.

Choose one answer.

	a. The protein release factor binds to a stop codon at the A site of the ribosome
	b. An uncharged tRNA is bound to a stop codon at the A site of the ribosome
	c. A termination factor cleaves off the growing polypeptide chain
	d. The mRNA ends at the stop codon and runs off the ribosome

Question 49

The anticodon for tryptophan (Trp) is 5'-CCA-3'. Which mRNA codon would the Trp-tRNA pair with?

Choose one answer.

	a. 3'-CCA-5'
	b. 5'-CCA-3'
	c. 3'-UGG-3'
	d. 5'-UGG-3'

Question 50

The selection of the starter methionine codon is helped by the _____ in prokaryotes and _____ in eukaryotes. Both sequences are at the 5' end of the mRNA.

Choose one answer.

	a. Kozak sequence; also by the Kozak;
	b. Shine-Delgarno sequence; by the Kozak sequence
	c. Kozak sequence; by the Shine-Delgarno sequence
	d. Shine-Delgarno sequence; also by the Shine-Delgarno sequence

Question 51

Use the standard genetic code table to determine which mRNA codes for the following protein: Met-Arg-Gly-Tyr-Ala-Arg.

Choose one answer.

	a. ATGCGAGGCTATGCUCGGTGA
	b. AUGCGAGGCUAUGCUCGGUGA
	c. AGUGGCUCGUAUGGGAGCGUA
	d. AGTGGCTCGTATGGGAGCGTA

Question 52

Which of the following is true about these nucleic acids?

Choose one answer.

	a. The template of the RNA can be ssDNA-2; ssDNA-1 is unrelated
	b. The template of the RNA can be ssDNA-1; ssDNA-2 is unrelated
	c. ssDNA-1 and ssDNA-2 can be complement strands, but they are unrelated to the RNA
	d. All three nucleic acids are unrelated

Question 53

Which of the following is true regarding open reading frames?

Choose one answer.

	a. DNA sequences can be read in six open reading frames: three forward and three reverse
	b. DNA sequences can be read in three open reading frames: three forward
	c. DNA sequences can be read in one open reading frame: one forward
	d. DNA sequences can be read in two open reading frames: one forward and one reverse

Question 54

Which of the following statement is true?

Choose one answer.

	a. Aminoacyl-transfer RNA synthetase has no proofreading activity.
	b. tRNA spontaneously reacts with an amino acid, since this reaction is thermodynamically favorable.
	c. Aminoacyl-transfer RNA synthetase links the carboxyl group of an amino acid to a tRNA ribose hydroxyl group through an ester bond.
	d. Only one enzyme is needed to charge all tRNAs with the appropriate amino acid.

Question 55

_____ is used in the third anticodon base position of the tRNA to allow the recognition of _____ by one base.

Choose one answer.

	a. Inosine; A, C, U
	b. Nicotinamide; G, U
	c. Flavin; A, G, U
	d. Niacin; A, U

Question 56

How many nucleotides are in the coding region of a eukaryotic mRNA, including the start and the stop codons?

Choose one answer.

	a. 112
	b. 150
	c. 173
	d. 211

Question 57

In E. coli, the gene lacI codes the lac operon repressor. Which of the following statements is true about an E. coli strain, which is lacI-, that is null mutant for lacI.

Choose one answer.

	a. There would be no lac operon repression, thus lacA, lacZ and lacY genes would be constitutively expressed regardless of the presence of lactose.
	b. There would be no lac operon repression, thus lacA, lacZ and lacY genes would be expressed in the presence of lactose.
	c. There would be no lac operon repression, thus lacA, lacZ and lacY genes would be constitutively expressed regardless of the presence of glucose.
	d. There would be no lac operon repression, thus lacA, lacZ and lacY genes would be expressed in the presence of allolactose.

Question 58

Methylation is an epigenetic change, which chemically modifies ______ in the chromosome.

Choose one answer.

	a. DNA and histones
	b. DNA
	c. Histone
	d. RNA

Question 59

Repressible operons are typical in _____, e.g., the _____. And inducible operons are typical in _____, e.g., the _____.

Choose one answer.

	a. Catabolic pathways; lac operon; anabolic pathways; trp operon
	b. Catabolic pathways; trp operon; anabolic pathways; lac operon
	c. Anabolic pathways; lac operon; catabolic pathways; trp operon
	d. Anabolic pathways; trp operon; catabolic pathways; lac operon

Question 60

The DNA methylation pattern, what we inherit from our parents, is _____; the DNA methylation pattern, what we acquire as we age, is _____. _____ can be inherited.

Choose one answer.

	a. Denomic imprinting; de novo methylation; none of them
	b. De novo methylation; genomic imprinting; none of them
	c. Genomic imprinting; de novo methylation; both of them
	d. Genomic imprinting; de novo methylation; none of them

Question 61

When lactose is _____, the lac operon is _____, since a _____ binding to the operator within the operon.

Choose one answer.

	a. Absent; inactive; repressor is
	b. Present; inactive; repressor is not
	c. Absent; active; repressor is not
	d. Present; active; repressor is

Question 62

When tryptophan is present in sufficient quantities, the trp operon is _____, since the _____ binds to the operator within the operon.

Choose one answer.

	a. Turned off; tryptophan-activated repressor
	b. Turned on; tryptophan-activated repressor
	c. Turned off; tryptophan-inhibited repressor
	d. Turned on; tryptophan-inhibited repressor

Question 63

_____ is determined by the _____ of activators that are available in a particular tissue to bind to genomic enhancer regions.

Choose one answer.

	a. Tissue specific gene expression; combination
	b. Genomic imprinting; absence
	c. X inactivation; absence
	d. Development; abundance

Question 64

_____ activates the lac operon, when the _____ level is low.

Choose one answer.

	a. Catabolite activator protein (CAP); lactose
	b. Allolactose; cAMP
	c. The catabolite activator protein (CAP); glucose
	d. cAMP; lactose

Question 65

DNA repair mechanisms can excise ______.

Choose one answer.

	a. Either altered bases or nucleotides
	b. Only altered bases by cleaving the base-sugar bonds
	c. Only nucleotides by cleaving phosphodiester bonds
	d. Only apurinic sites

Question 66

Hypermutation in immunoglobulins is the result of an unusual ______ response: the ______ strand is corrected, not the ______ strand.

Choose one answer.

	a. Mismatch repair; daughter; parent
	b. Mutagen activity; daughter; parent
	c. Mismatch repair; parent; daughter
	d. Mutagen activity; parent; daughter

Question 67

Loss-of-function mutation generally results in ______

Choose one answer.

	a. Slower protein turnover
	b. No gene product
	c. Lower metabolic rate
	d. Loss of inhibition

Question 68

The mismatch repair system has to recognize the ______ strand and repair mutations only in this strand. To achieve this, bacteria is utilizing the postreplicational delay in ______.

Choose one answer.

	a. New; adenine methylation
	b. Old; adenine methylation
	c. New; Okazaki fragment ligation
	d. New; Okazaki fragment ligation

Question 69

The replicated strand of the DNA is repaired ______ the parent strand.

Choose one answer.

	a. More rapidly than
	b. At the same rate as
	c. Less rapidly than
	d. Less efficiently than

Question 70

The ______ response repair is ______, since it fills a gap at the parental side after replication.

Choose one answer.

	a. SOS; inaccurate
	b. Recombinational; error-prone
	c. Postreplicational; always high fidelity
	d. SOS; high fidelity

Question 71

Which of the following conditions is the consequence of a translocation event between nonhomologous chromosomes?

Choose one answer.

	a. Cystic fibrosis
	b. Fragile X syndrome
	c. Philadelphia syndrome
	d. Huntington's disease

Question 72

We are talking about mutation when an allele is different from the wild type allele. The most dramatic change is the consequence of a(n) ______ mutation, which is introducing an ORF into the transcript.

Choose one answer.

	a. Early nonsense
	b. Early silent
	c. Late missense
	d. Late frameshift

Question 73

BRCA1 and BRCA 2 genes are involved in the ______.

Choose one answer.

	a. SOS repair mechanism
	b. Initiating DNA replication
	c. Homologous recombination of chromosomes
	d. Terminating RNA transcription

Question 74

During ______, cromatids take place, which results in genetic ______ and contributes to DNA repair.

Choose one answer.

	a. Crossing over of nonsister; variability
	b. Crossing over of sister; variability
	c. Crossing over of nonsister; stability
	d. Crossing over of sister; stability

Question 75

Retrotransposons use a ______ and a ______ during their relocation into a new site in the chromosome.

Choose one answer.

	a. RNA intermadiate; retrotransposase
	b. DNA intermediate; retrotransposase
	c. RNA intermediate; reverse transcriptase
	d. DNA intermediate; reverse transcriptase

Question 76

Retroviruses ______ insert into the host genome and ______ move around in the genome as a transposon.

Choose one answer.

	a. Can; can
	b. Can; cannot
	c. Cannot; cannot
	d. Cannot; can

Question 77

The Holiday junction is a model for______.

Choose one answer.

	a. DNA crossover
	b. DNA ligation
	c. SOS gap repair
	d. PCR amplification

Question 78

Transposons are jumping genes, but none of them can move around by ______.

Choose one answer.

	a. Retrotransposase
	b. The cut-and-paste mechanism
	c. The involvement of a reverse transcriptase
	d. The copy-and-paste mechanism

Question 79

______ may result in novel ______ of domains from different proteins.

Choose one answer.

	a. Exon shuffling; combination
	b. Alternative splicing; combination
	c. Exon shuffling; conformation
	d. Alternative splicing; conformation

Question 80

Which of the following is not a DNA damage type?

Choose one answer.

	a. Mismatch
	b. Strand separation
	c. Backbone break
	d. Crosslink between bases

Question 81

A cloning plasmid typically has a(n) ______, a ______, and a______.

Choose one answer.

	a. Antibiotic resistance gene; cloning site; reporter gene
	b. Restriction enzyme gene; ligase gene; repair gene
	c. PCR amplified segment; GC-rich region; reporter gene
	d. Antibiotic resistance gene; ligation site; repair gene

Question 82

CGATTGCAGGTTATAGCG. Which of the following primer pair can be used to amplify this template with PCR?

Choose one answer.

	a. GCTAA and TAGCG
	b. GCTAA and CGCTA
	c. CGATT and TAGCG
	d. CGATT and CGCTA

Question 83

Cloning vectors utilize ______, wherein the ______ DNA can be inserted.

Choose one answer.

	a. Multiple-cloning site; foreign
	b. Ligation site; foreign
	c. PCR site; antibiotic resistance gene
	d. Insertion site; reporter gene

Question 84

DNA fragments with ______ ends can be easily joined by a ______, if the fragments are made by one restriction enzyme.

Choose one answer.

	a. Sticky; ligase
	b. Blunt; ligase
	c. Sticky; DNA polymerase
	d. Blunt; DNA polymerase

Question 85

Ligases ______ DNA segments by _____.

Choose one answer.

	a. Link; phosphodiester bonds
	b. Repair; excision
	c. Restrict the replication of; linking them to lamins
	d. Link RNA primer to; phosphodiester bond at the beginning of the replication

Question 86

Restriction enzymes are ______ that ______ the DNA at specific ______.

Choose one answer.

	a. Ligases; seal fragments of; sites
	b. DNases; cut; developmental stages
	c. Molecular scissors; cut; recognition sites
	d. Polymerases; replicate; locations

Question 87

The key of the dideoxy DNA sequencing method is the missing ______.

Choose one answer.

	a. 3'OH of the sugar
	b. 2'OH of the sugar
	c. Terminal phosphate group
	d. Chain terminating polymerase

Question 88

There is a ______ fold amplification after six completed PCR cycles.

Choose one answer.

	a. 16
	b. 32
	c. 64
	d. 128

Question 89

Which of the following method is paired wrongly with its product?

Choose one answer.

	a. Polymerase chain reaction-DNA amplification
	b. Ion exchange chromatography-purified RNA
	c. Restriction enzyme digestion-DNA fragments
	d. Ligation-joined DNA fragments

Question 90

______ are frequently used in cloning plasmid, and they are enzyme genes. They include a ______, where the foreign gene can be inserted. The insertion results in the ______ of the enzyme activity, which is often followed by a color reaction.

Choose one answer.

	a. Reporter genes; cloning site; disruption
	b. Antibiotic resistance genes; cloning site; inhibition
	c. Multicloning sites; restriction enzyme recognition site; amplification
	d. PCR sites; restriction enzyme recognition site; amplification

Question 91

______ extracts proteins utilizing specific interactions.

Choose one answer.

	a. Ion exchange chromatography
	b. Affinity chromatography
	c. Ultracentrifugation
	d. 2D gelelectrophoresis

Question 92

Electrophoresis is separating molecules based on their______.

Choose one answer.

	a. Charge
	b. Charge and size
	c. Size
	d. Shape

Question 93

Molecular biology research resulted in many ______ transgenic mouse strains. Mouse is the most commonly used transgenic mammal in gene function discovery.

Choose one answer.

	a. Knock-out and knock-in
	b. Transposon induced
	c. Mutagen induced
	d. Knock over

Question 94

The insertion of the foreign DNA has often been checked by the ______blot technique.

Choose one answer.

	a. Southern
	b. Western
	c. Northern
	d. Protein

Question 95

Traditional breeding, just like transgenic technology, results in organisms that have desired traits. A major difference is that transgenic technology moves genes______, while traditional breeding crosses individuals ______.

Choose one answer.

	a. From one species to another; within a species
	b. Within a species; from different species
	c. And produces new strains slowly; and gets the result within a generation
	d. but the produced strains are not homogenous; and easily gets clones

Question 96

______ is a favorite model organism from the early days of genetics. It taught us how to link gene distance and genetic recombination frequencies, body plan development, and molecular mechanisms of learning and memory, just to mention a few.

Choose one answer.

	a. Escherichia coli
	b. Saccharomyces cerevisiae
	c. Caenorhabditis elegans
	d. Drosophila melanogaster

Question 97

______ is a transparent animal with 556 cells. The basic mechanism of programmed cell death has been deciphered in this model organism.

Choose one answer.

	a. Escherichia coli
	b. Saccharomyces cerevisiae
	c. Caenorhabditis elegans
	d. Drosophila melanogaster

Question 98

______ is perhaps the most common eukaryote in molecular biology labs. It is also widely used in commercial fermentation applications.

Choose one answer.

	a. Escherichia coli
	b. Saccharomyces cerevisiae
	c. Caenorhabditis elegans
	d. Penicillium chrysogenum

Question 99

______ is the most successfully used plant model organism. It taught us the basics of plant physiology, and it is also the most frequently used plant model for GMO pilot experiments.

Choose one answer.

	a. Arabidopsis thaliana
	b. Zea mays
	c. Oryza sativa
	d. Allium cepa

Question 100

______ is perhaps the most common prokaryote in molecular biology labs. It is also widely used by the biotech industry to manufacture proteins, e.g., insulin.

Choose one answer.

	a. Escherichia coli
	b. Saccharomyces cerevisiae
	c. Caenorhabditis elegans
	d. Penicillium chrysogenum